This is not surprising, as clines are not expected in cases of sharp changes in haplogroup frequency over a relatively small distance such as those observed for hg G, for instance between the Caucasus and Eastern Europe. Nat Commun 2012; 3. de Knijff P, Kayser M, Caglia A et al. [12] The fourth site also from the same period is the tztal of the Italian Alps where the mummified remains of tzi the Iceman were discovered. Its chromosome location listed as 21653414. In contrast, the only U1 representative in Europe is the G-M527 lineage whose distribution pattern is consistent with regions of Greek colonization. Princeton: Princeton University Press, 1994. To accommodate for variability in sample sizes and hg G content, haplogroup diversity was calculated using the method of Nei37 only in the 52 instances when total population sample size exceeded 50 individuals and 5hg G chromosomes were observed. Haplogroup G2a1 (also known as G-FGC753 and previously as G-L293) and its subclades represent the majority of haplogroup G samples in some parts of the Caucasus Mountains area. (a) Principal component analysis by population. G2a2b2a is also found in India. This is achieved by comparing the haplotypes through the STR markers. There are seeming pockets of unusual concentrations within Europe. This haplogroup was found in a Neolithic skeleton from around 5000 BC, in the cemetery of Derenburg Meerenstieg II, Germany, which forms part of the Linear Pottery culture, known in German as Linearbandkeramik (LBK),[11] but was not tested for G2a3 subclades. Haplogroup G, together with J2 clades, has been associated with the spread of agriculture, especially in the European context. G is found mostly in the north central Middle East and the Caucasus, with smaller numbers around the Mediterranean and eastward. Dulik MC, Osipova LP, Schurr TG : Y-chromosome variation in Altaian Kazakhs reveals a common paternal gene pool for Kazakhs and the influence of Mongolian expansions. Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood. The oldest skeletons confirmed by ancient DNA testing as carrying haplogroup G2a were five found in the Avellaner cave burial site, near Les Planes d'Hostoles, in Catalonia, Spain and were dated by radiocarbon dating to about 5000 BCE. Then we applied a 10% overall hg G frequency threshold and the additional specification that both haplogroup G1 and G2 lineages also be present. Eur J Hum Genet 2010; 18: 348353. While acknowledging that the inference of the age and geographic source of dispersals of Y chromosome haplogroups from the frequency and STR diversity data can be approximate at best, we speculate that this lineage could potentially be associated with the Linearbandkeramik (LBK) culture of Central Europe, as its highest frequency (3.45.1%) and Td estimate (Supplementary Table S4) of 108703029 years ago occur there. [36], G-PF3359 (or G2a2b2b; previously G2a3b2) was known prior to 2013 as G-L177. Correspondence to King RJ, DiCristofaro J, Kouvatsi A et al. Haplogroup G (M201) is a human Y-chromosome haplogroup. In addition, we introduce five new markers: M426, M461, M485, M527 and M547 (Supplementary Table S2). Samples have been identified in England, Germany, Montenegro (Bosniak), Spain, Cyprus (Greek), Turkey, Armenia, Georgia, Lebanon, Syria and Kuwait. Internet Explorer). the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Included within G-L91 are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not L91+. Yunusbayev B, Metspalu M, Jrve M et al. Thus, these estimates should be viewed as the upper bounds of dispersal times. Such temporal estimates must be viewed with caution owing to differences in individual STR locus mutation rates, sensitivity to rare outlier STR alleles and complexities related to multiple potential founders during a demographic event. We emphasize that our assessments are based solely on contemporary DNA distributions rather than actual prehistoric patterns. Use the Previous and Next buttons to navigate the slides or the slide controller buttons at the end to navigate through each slide. These two reported Pakistani G-M377 haplotypes are quite divergent from the Ashkenazi Jewish clade, and therefore do not at all indicate a recent common origin. G2a was found in medieval remains in a 7th- century CE high-status tomb in Ergolding, Bavaria, Germany, but G2a subclades were not tested.[34]. Mol Biol Evol 2006; 23: 22682270. and JavaScript. This video explains the migration route of Y-chromosome haplogroup G and the countries where it can be found today. The network was obtained using the biallelic markers P303, M426, L497, U1, M527 and 19 STR loci (DYS19, DYS388, DYS389I, DYS389b, DYS390, DYS391, DYS392, DYS393, DYS439, DYS461 (TAGA counts), DYS385a,b, DYS437, DYS438, DYS448, DYS456, DYS458, DYS635, YGATAH4). Notably no basal G-M201*, Page94*(xM285, P287) chromosomes were detected in our data set. Haplogroup S, as of 2017, is also known as K2b1a. The reliability of both P16 and P18 in identifying everyone in each of these categories has been questioned and individual components of the SNP have to be examined. Ancient DNA reveals male diffusion through the Neolithic Mediterranean route. Eur J Hum Genet 2008; 16: 374386. Encyclopedia of mtDNA Origins - Discover your maternal lineage. Haplogroup G1 is a primary subclade of haplogroup G . The extreme rarity of G-M377 in northern Pakistan could indicate that G2b in this area originates outside the region and was brought there in the historic period, perhaps from further west (Pakistan was part of both the Achaemenid Persian Empire, conquered by Alexander the Great, and then formed a part of the Greco-Bactrian Kingdom). Whereas the presence of Mideastern mtDNA in Tuscany43 supports the model of early Iron Age migrants from Anatolia (putative Etruscans) colonizing Central Italy,44 the occurrence of the G2a3b1c-L497 lineage in Italy is most likely associated to migratory flows from the north. Capelli C, Brisighelli F, Scarnicci F, Blanco-Verea A, Brion M, Pascali VL : Phylogenetic evidence for multiple independent duplication events at the DYS19 locus. The next largest subclade of G-P303 is characterized by the presence of the U1 mutation. So far all G2a1 persons have a value of 10 at STR marker DYS392. The formula for the coalescence calculations is as follows: Age=25/1000 ASD0/0.00069. The haplogroup G mutation developed about 21,000 to 14,000 years ago. For the human mtDNA haplogroup, see. White PS, Tatum OL, Deaven LL, Longmire JL : New, male-specific microsatellite markers from the human Y chromosome. The hg G2a3b1c-L497 sub-cluster, on the other hand, has so far been found essentially in European populations and therefore is probably autochthonous to Europe. First, the G2a1-P16 lineage is effectively Caucasus specific and accounts for about one-third of the Caucasian male gene pool (Figure 2f). If a sample meets the criteria indicated for these three markers, it is likely the sample is G2a2b1. In Turkey, the South Caucasus and Iran, haplogroup G reaches the highest percentage of national populations. SR thanks the Estonian Science Foundation for grant 7445 and M Metspalu for grant 8973. ), Haplogroup M, as of 2017, is also known as K2b1b. Nonetheless, our approach using high-resolution phylogenetic relationships as well as their phylogeography to infer the possible origin of a genetic variant provides a more plausible deduction than simply the region of highest frequency. Men with the haplogroup G marker moved into Europe in Neolithic times. Principal component analysis based on G sub-haplogroup frequencies was performed using the freeware POPSTR program (http://harpending.humanevo.utah.edu/popstr/). This skeleton could not be dated by radiocarbon dating, but other skeletons there were dated to between 5,100 and 6,100 years old. G2a1a persons also typically have higher values for DYS385b, such as 16, 17 or 18, than seen in most G persons. ISSN 1476-5438 (online) Origin. Y-chromosomal diversity in Europe is clinal and influenced primarily by geography, rather than by language. The 12f2a mutation, which characterizes haplogroup J, was observed in 445 subjects. L2b1a. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. [16] The concentration of G falls below this average in Scandinavia, the westernmost former Soviet republics and Poland, as well as in Iceland and the British Isles. We performed principal component analysis to determine the affinities of various hg G fractions with respect to total M201 among different populations, using the frequency distributions of the following sub-clades: M285, P20, M377, M287, P287, P15*, P16, M286, M485, P303*, L497, U1*, M527, M406 and Page19. Pichler I, Fuchsberger C, Platzer C et al. Cinnioglu C, King R, Kivisild T et al. G1-M285, previously described in the Iranian population . We attempted to localize the potential geographic origin of . These Neolithic European were descendants of Neolithic farmers from Anatolia, among some of the earliest peoples in the world to practice agriculture. While neither knowledge of paleo-climate, archeology or genetic evidence from a single locus using modern populations provides an unimpeachable microcosm of pre-historical expansions, considering them together cautiously provides a contextual framework for discussion. Cadenas AM, Zhivotovsky LA, Cavalli-Sforza LL, Underhill PA, Herrera RJ : Y-chromosome diversity characterizes the Gulf of Oman. The L91 mutation is found at 21327383 and rs35474563 on the Y-chromosome. The North Ossetians in the mid northern Caucasus area of Russia belong overwhelmingly to the G2a1 subclade based on available samples. PubMed Haplogroup G, together with J2 clades, has been associated with the spread of agriculture, especially in the European context. The Caucasus as an asymmetric semipermeable barrier to ancient human migrations. [20] The city is on the banks of the river Drava, which notably begins in the Tirol/Tyrol region of the Alps, another haplogroup G focus area in Europe. suggested that: "We estimate that the geographic origin of haplogroup G plausibly locates somewhere nearby eastern Anatolia, Armenia or western Iran. We genotyped binary markers following PCR amplification, by either Denaturing High Performance Liquid Chromatography, RFLP analysis, Taqman assay (Applied Biosystems, Foster City, CA, USA) or direct Sanger sequencing methodology. Am J Hum Genet 2006; 78: 202221. (This followed the publication of: Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS. In Russia, Ukraine and Central Asia, members of various ethnic minorities and/or residents in particular localities possess G-M201 at its highest levels in the world even though the average rate at the national level is about 1% or less. It is a branch of haplogroup G (Y-DNA) (M201). The complexity is apparent in both the phylogenetic resolution and geographic patterning within hgs G and J2a. Am J Hum Genet 2004; 74: 5061. Ann Hum Genet 2008; 72: 205214. G2a3a-M406 has a modest presence in Thessaly and the Peloponnese (4%),10 areas of the initial Greek Neolithic settlements. Article Mitochondrial DNA and Y Chromosome Variation Provides Evidence for a Recent Common Ancestry between Native Americans and Indigenous Altaians. It is not found among Native Americans except where intermarriage with non-native persons has occurred. K-M2313*, which as yet has no phylogenetic name, has been documented in two living individuals, who have ethnic ties to India and South East Asia. No clinal patterns were detected suggesting that the distributions are rather indicative of isolation by distance and demographic complexities. The most probably region of the initial phase of G-M201 is estimated to be in Anatolia, Armenia or western Iran. A subset of 693 samples was typed for short tandem repeats of Y-chromosome (Y-STRs) using the 17 STR markers in the Applied Biosystems AmpFlSTR Yfiler Kit according to manufacturer recommendations. Men from the Caucasus and men from eastern Europe also form distinctive STR clusters. Circles represent microsatellite haplotypes, the areas of the circles and sectors are proportional to haplotype frequency (smallest circle corresponds to one individual) and the geographic area is indicated by color. Although progress has been recently made in resolving the haplogroup G phylogeny, a comprehensive survey of the geographic distribution patterns of the significant sub-clades of this haplogroup has not been conducted yet. The non-clustering paraphyletic, hg G sub-group P303* residuals consist of samples from Near/Middle Eastern, Caucasian and European populations. They arewith accompanying Y-chromosome locationsU5 (rs2178500), L149 (8486380) and L31 (also called S149) (rs35617575..12538148). BMC Evol Biol 2011; 11: 69. This group was created for the folks who's paternal Y-DNA reflects they belong to haplogroup G2a (G-P15). Hum Genet 2004; 114: 127148. The most commonly occurring subclades are G1* (M285) and many subclades of G2 (G-P287), especially: G2a (P15), G2a1 (G-FGC7535, formerly G-L293), G2a2b2a (G-P303) formerly G2a3b1); G2a2b1 (G-M406) formerly G2a3a; G2a2b2a1 (G-L140) formerly G2a3b1a; G2a2b2a1a1b (G-L497) formerly G2a3b1a2; G2a2b2a1a1a1 (G-L13) formerly G2a3b1a1a; G2a2b2a1a1c1a (G-CTS5990 or G-Z1903) formerly G2a3b1a3; G2b (G-M3115) and; G2b1 (G-M377), formerly G2b. Am J Hum Genet 2001; 68: 10191029. Hammer MF, Behar DM, Karafet TM et al. Although the low frequency of hg G1-M285 makes it impractical to justify displaying a spatial frequency map, it is found (Supplementary Table S1) in the Near/Middle East including Anatolia, the Arabian Peninsula and Persian Gulf region, as well as Iran and the South Caucasus (mostly Armenians). Y-DNA haplogroups are useful to determine whether two apparently unrelated individuals sharing the same surname do indeed descend from a common ancestor in a not too distant past (3 to 20 generations). Its estimated Td of 120953000 years ago suggests considerable antiquity allowing time to accumulate STR diversity and also to disperse relatively widely. G-PF3147 (previously G-L223 and G-PF3146) is characterized by having the L223 mutation. Although no basal G-M201* chromosomes were detected in our data set, the homeland of this haplogroup has been estimated to be somewhere nearby eastern Anatolia, Armenia or western Iran, the only areas characterized by the co-presence of deep basal branches as well as the occurrence of high sub-haplogroup diversity. [43] L240 was identified in 2009. First, here is the only region with co-presence of deep basal branches as well as the occurrence of high sub-haplogroup diversity of haplogroup G. Although the phylogenetic resolution within hg G has progressed,1, 17 a comprehensive survey of the geographic distribution patterns of significant hg G sub-clades has not been conducted. It has an extremely low frequency in modern populations, except (i) Iran and its western neighbors, and (ii) a region straddling south Central Siberia (Russia) and northern Kazakhstan. Kayser M, Caglia A, Corach D et al. The second common hg G lineage in the Caucasus is U1, which has its highest frequencies in the South (22.8% in Abkhazians) and NW Caucasus (about 39.7% in Adyghe and 36.5% in Cherkessians), but also reaches the Near/Middle East with the highest frequency in Palestinians (16.7%) and, shows extremely low frequency in Eastern Europe. Haplogroup H dominates present-day Western European mitochondrial DNA variability (>40%), yet was less common (~19%) among Early Neolithic farmers (~5450 BC) and virtually absent in Mesolithic . For the multi-copy STR DYS389I,II the DYS389b value was DYS389I subtracted from DYS389II. In north-eastern Croatia, in the town of Osijek, G was found in 14% of the males. 25 and 0.00069 denote the assumed average generation time in years and the effective mutation rate, respectively, and 1000 is used to convert the result of the equation (into thousands of years). In addition, K-Y28299, which appears to be a primary branch of K-M2313, has been found in three living individuals from India. In the meantime, to ensure continued support, we are displaying the site without styles Y chromosome genetic variation in the Italian peninsula is clinal and supports an admixture model for the Mesolithic-Neolithic encounter. The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y chromosome perspective. Artefactual values below 0% values were not depicted. The haplogroups contain many branches called subhaplogroups or subclades. Ancient DNA from European early neolithic farmers reveals their near eastern affinities. contracts here. Spallanzani, Universit di Pavia, Pavia, Italy, Viola Grugni,Vincenza Battaglia,Carmela Nici,Francesca Crobu,Sena Karachanak,Baharak Hooshiar Kashani&Ornella Semino, Department of Medical Genetics, Medical University of Sofia, Sofia, Bulgaria, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran, Istituto di Genetica Molecolare Centro Nazionale delle Ricerche, Pavia, Italy, Centro Interdipartimentale Studi di Genere, Universit di Pavia, Pavia, Italy, Unit Mixte de Recherche 6578, Centre National de la Recherche Scientifique, and Etablissement Franais du Sang, Biocultural Anthropology, Medical Faculty, Universit de la Mditerrane, Marseille, France, Estonian Academy of Sciences, Tallinn, Estonia, Department of Biological Anthropology, University of Cambridge, Cambridge, UK, Department of Genetics, Stanford University School of Medicine, Stanford, CA, USA, You can also search for this author in Martinez L, Underhill PA, Zhivotovsky LA et al. The presence of hg G was first reported in Europe and Georgia5 and later described in additional populations of the Caucasus.6 Subsequently, several data sets containing hg G-related lineages have been presented in studies of different European populations7, 8, 9, 10 and so on, as well as studies involving several Middle Eastern and South Asian populations.4, 11, 12, 13, Hg G, together with J2 clades, has been associated with the spread of agriculture,5 especially in the European context. This group has been linked with the Crypto-Jewish population which fled to the island during the time of the Spanish Inquisition, of which a significant portion are identifiable as G-Z725 (DYS388=13). Unresolved G2a-P15* lineages occur across a wide area extending from the Near/Middle East to the Balkans and Western Europe in the west, the Caucasus (especially the South Caucasus) in the north and Pakistan in the east. IK thanks the Russian Foundation for Basic Research for grant 08-06-97011 and the Grant of the President of the Russian Federation of state support for young Russian scientists MK-488.2006.4. Human Y chromosome DNA grouping common in western Eurasia, This article is about the human Y-DNA haplogroup. L141 persons who do not belong to any L141 subclade so far have the value of 11 at STR marker DYS490 a finding rare in other G categories. Members of this group have been found in Europe and the Middle East.[3]. Achilli A, Olivieri A, Pala M et al. Eur J Hum Genet 2004; 12: 855863. Proc Natl Acad Sci USA 2011; 108: 97889791. In the Near/Middle East, the highest P303 frequency is detected among Palestinians (17.8%), whereas in Europe the frequency does not exceed 6%. Pericic M, Lauc LB, Klaric IM, Janicijevic B, Rudan P : Review of croatian genetic heritage as revealed by mitochondrial DNA and Y chromosomal lineages. It is one of two branches of the parent haplogroup GHIJK, the other being HIJK. In the northern and highland areas of the island of Sardinia off western Italy, G percentages reach 11% of the population in one study[17] and reached 21% in the town of Tempio in another study. Origin. For this are several indications. The hg G individuals in Supplementary Table S1 were either first genotyped for this study or updated to present phylogenetic resolution from earlier studies.2, 4, 10, 11, 13, 16, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 All hg G (M201-derived) samples were genotyped in a hierarchical manner for the following binary markers: M285, P20, P287, P15, L91 P16, M286, P303, U1, L497, M406, Page19, M287 and M377.
Brisbane Mum Influencers,
Names Of The 7 Gates Of Hell,
Laurieton Funeral Notices,
Guess My Name By My Picture,
Articles H
